Phylogenetics — the study of evolutionary relationships between organisms — has traditionally relied on multiple sequence alignment (MSA) as a first step. While MSA works well for closely related sequences, it becomes painfully slow and computationally expensive when you scale to hundreds or thousands of sequences, especially across diverse taxa.

Covary, developed by ChordexBio, takes a different approach: it skips alignment altogether. Instead, it uses translation-aware, alignment-free embeddings powered by deep learning (via TIPs-VF) to represent and compare genetic sequences — enabling fast, scalable phylogenomic analyses. The framework is described in full in the preprint published on bioRxiv (2025).

This guide will walk you through running Covary from scratch — no prior bioinformatics experience required. All you need is a multi-FASTA file, a Google account, and about 30–60 minutes of your time.


What is Covary, and why does it matter?

At its core, Covary transforms each DNA sequence into a numerical vector — a compact mathematical representation that captures the sequence's composition, length, position, and even codon-level (translation-aware) features. These vectors can then be compared, clustered, and visualized without ever needing to align sequences to each other.

Key capabilities include:

  • Alignment-free analysis — no MSA required, dramatically reducing compute time for large datasets.
  • Translation-aware embeddings — biologically meaningful representations that work on both coding and non-coding sequences.
  • Distance-based clustering — generates Euclidean pairwise distance matrices for downstream clustering and tree building.
  • Multi-level taxonomic resolution — can distinguish sequences at species, genus, family, and order levels.
  • Rich visualizations — heatmaps, dendrograms, and scatter plots (PCA, t-SNE, UMAP) out of the box.

Covary has been benchmarked on datasets including 906 whole-genome sequences of SARS-CoV-2 in a single run, with smooth performance on a GPU runtime.


Before you begin: What you will need

  • A Google account (to access Google Colab)
  • A multi-FASTA file of DNA sequences (see format below)
  • Covary v2.x or above (research license maybe required) — no local installation required
  • A GPU runtime in Colab (free T4 GPU is sufficient for most analyses)
💡 Note on RNA sequences: Covary accepts DNA sequences (A, T, C, G). If you have RNA data, convert U → T before uploading. Covary's k-mer encoder is optimized for the DNA alphabet.

Step 1 — Prepare your multi-FASTA file

Your input must be a multi-FASTA file: a plain text file where each sequence entry begins with a > header line followed by the nucleotide sequence. Here is a sample from the Covary documentation using 16S ribosomal RNA sequences of Thermus species:

>NR_181868.1 Thermus brevis strain SYSU G05001 16S ribosomal RNA, partial sequence
GACATGCAAGTCGAGCGGGGCGGGTTTATACCTGCCCAGCGGCGGACGGGTGAGTAACGC
GTGGGTGACCTACCTGGAAGAGGCGGACAACCTGGGGAAACCCAGGCTAATCCGCCATGT
GGTCCTGTCCTGTGGGGCAGGACTAAAGGGTGGATAGCCCGCTTCCGGATGGGCCCGCGT
CCCATCAGCTAGTTGGTGGGGTAAGAGCCCACCAAGGCGACGACGGGTAGCCGGTCTGAG
 
>NR_181790.1 Thermus brevis strain SYSU G05002 16S ribosomal RNA, partial sequence
GACATGCAAGTCGAGCGGGGCGGGTTTATACCTGCCCAGCGGCGGACGGGTGAGTAACGC
GTGGGTGACCTACCTGGAAGAGGCGGACAACCTGGGGAAACCCAGGCTAATCCGCCATGT
GGTCCTGTCCTGTGGGGCAGGACTAAAGGGTGGATAGCCCGCTTCCGGATGGGCCCGCGT
CCCATCAGCTAGTTGGTGGGGTAAGAGCCCACCAAGGCGACGACGGGTAGCCGGTCTGAG
 
>NR_180714.1 Thermus sediminis strain L198 16S ribosomal RNA, partial sequence
GACATGCAAGTCGTGCGGGCCGTGGGGTTTCTCACGGCTAGCGGCGGACGGGTGAGTAAC
GCGTGGGTGACCTACCCGGAAGAGGGGGACAACCTGGGGAAACCCAGGCTAATCCCCCAT
GTGGACGCATCCTGTGGGGTGCGTTCAAAGGGCGTTGCCCGCTTCCGGATGGGCCCGCGT
CCCATCAGCCAGTTGGTGGGGTAAAGGCCCACCAAGGCGACGACGGGTAGCCGGTCTGAG

Tips for preparing your FASTA file:

  1. Each entry must start with > followed by a unique accession or identifier.
  2. Remove any extra whitespace, blank lines within sequences, or non-standard characters.
  3. Avoid sequences with excessive ambiguous bases (Ns) — by default, Covary filters entries containing non-ATCG characters. You can override this in parameters (include_N = "yes").
  4. Both partial and complete sequences are accepted.
  5. For sequences with inconsistent start positions (e.g., circular genomes), consider using Seed Aligner to standardize entry points without full MSA.

📂 Sample datasets: The Covary GitHub repository includes test datasets in the /testing and /early validations folders. These are excellent starting points if you want to run Covary before using your own data.


Step 2 — Open the Covary notebook in Google Colab

Covary runs entirely inside a Jupyter Notebook on Google Colab — no local installation, no package management, no environment setup. Everything is pre-configured in the notebook.

You have two options to launch it:

Option A: Direct link (recommended for beginners)

Click this link to open Covary v2.1 directly in Colab:
👉 Load Covary v2.1 on Colab

Option B: Programmatic launch (for advanced users)

Paste the following into any Colab cell to generate an open link programmatically:

from IPython.display import HTML
 
notebook = "Covary_v2_1.ipynb"  # Change version string here if needed
repo = "mahvin92/Covary"
folder = "notebook"
 
colab_url = f"https://colab.research.google.com/github/{repo}/blob/main/{folder}/{notebook}"
HTML(f'<a href="{colab_url}" target="_blank">Open {notebook} in Google Colab</a>')

All available notebooks can be browsed at the Covary notebook directory on GitHub.

⚠️ Always check that you are running the latest version. Visit the Covary releases page or the GitHub releases to confirm you have the most recent stable build (currently v2.1).

Step 3 — Set your runtime to GPU

Covary's deep learning step (Step 6 in the notebook) is memory-intensive. Before running anything, switch your runtime to use a GPU:

  1. In Colab, go to RuntimeChange runtime type.
  2. Under Hardware accelerator, select GPU (e.g., T4 — available on the free tier).
  3. Click Save.
⚠️ If your session crashes during Step 6 (deep learning), it almost certainly means you ran out of memory. Reconnect to a hosted GPU runtime and restart: go to RuntimeFactory reset runtime, then re-run from the beginning.

Step 4 — Configure parameters (Step 1 of the notebook)

Inside the notebook, Step 1 — Set parameters is where you control how Covary processes your data. Key parameters to know:

Parameter Default What it does
include_N "no" Whether to include sequences with non-ATCG characters (ambiguous bases). Set to "yes" to include them.
k (k-mer size) [6, newer versions will be supporting 3-mers] Controls the resolution of k-mer encoding. Larger k = more specific but sparser representation.
Linkage method All four (Ward, Average, Complete, Single) Determines how clusters are merged in dendrogram analysis. Ward linkage is generally recommended for compact, well-separated clusters.
Dimensionality reduction PCA, t-SNE, UMAP All three are computed by default and output separately in results.

Fields marked with ⚠️ inside the notebook require your attention — do not collapse them while Covary is running.


Step 5 — Upload your FASTA file (Step 2 of the notebook)

In Step 2 of the Covary notebook, you will be prompted to upload your multi-FASTA file. This is the only file you need to provide.

  1. When the file upload widget appears, click Choose Files.
  2. Select your .fasta or .fa file from your local machine. You can also save/upload them as .txt file
  3. Wait for the upload to complete before proceeding.

If you are working with a large dataset already stored in Google Drive, you can mount your Drive and reference the file path directly — avoiding repeated uploads across sessions.


Step 6 — Run the pipeline

Once parameters are set and your file is uploaded, running Covary is straightforward:

  1. In Colab, click RuntimeRun all.
  2. The notebook will execute each step sequentially — from QC and encoding (Steps 1–5) through deep learning and dimensionality reduction (Steps 6–7) to result export (Step 8).
  3. Monitor progress in each cell's output area. The deep learning step will take the longest — typically a few minutes on a T4 GPU, depending on dataset size.

What happens under the hood in each step:

  • Steps 1–2: Parameter setting and FASTA file upload.
  • Steps 3–4: Quality control — whitespace removal, filtering of invalid/ambiguous sequences.
  • Step 5: Sequence encoding via Covary-encoder into translation-aware k-mer vectors.
  • Step 6: Deep learning — model training on the encoded sequences. This is the GPU-intensive step.
  • Step 7: Dimensionality reduction (PCA, t-SNE, UMAP) and distance matrix computation.
  • Step 8: Result packaging and download trigger.

Step 7 — Download and interpret your results

Results are automatically packaged and a download should begin when Step 8 completes. If the download does not start, open the Files panel on the left sidebar in Colab and manually download from /content/covary_results.

The result ZIP file contains the following:

  1. Vector embeddings (.tsv) — raw numerical embeddings for each sequence, computed from PCA, t-SNE, and UMAP. These can be imported into R, Python, or visualization tools for custom analyses.
  2. Embedding scatter plots — scatter plots of Dimension 1 vs. Dimension 2, labeled by sequence entry. These are your primary "where do sequences sit in space?" visualizations.
  3. Heatmaps — Euclidean pairwise distance matrices visualized as heatmaps. Darker colors indicate higher similarity. Provided for each reduction method (PCA, t-SNE, UMAP).
  4. Dendrogram linkage data (.tsv) — numerical linkage data for hierarchical clustering across all four methods (Ward, Average, Complete, Single).
  5. Dendrogram plots — tree visualizations showing distances (x-axis) and sequence indices (y-axis) across different linkage methods and reduction analyses. These are your phylogenetic trees.
How to read dendrograms: Sequences that cluster together (join early at low distances on the x-axis) are more similar. Sequences that join late at high distances are more divergent. Compare results across linkage methods — consistent clustering across Ward and Average linkage generally indicates robust groupings.

Common use cases and what to expect

Classification

Group sequences into taxonomic categories by comparing their embeddings against established reference clades. For example: determining whether a newly sequenced bacterial strain belongs to an existing species or represents a novel taxon.

Identification

Match an unknown sequence to the closest evolutionary signature in a reference set. Useful for pathogen surveillance — e.g., identifying the source species of an emerging viral outbreak from sequencing data alone.

Phylogenetic relationship mapping

Reconstruct evolutionary trees showing lineage divergence and ancestry. Applicable to tracing tumor clonal evolution, studying pandemic spread, or comparing isolates across geographic regions.

Prediction

Estimate likely evolutionary trajectories or mutational outcomes. Covary can model how viral genomes may evolve resistance, or how tumor mutations might drive treatment relapse — supporting epidemiology and cancer genomics workflows.


Troubleshooting quick reference

  1. Session crashed at Step 6: You ran out of memory. Go to Runtime → Change runtime type → GPU (T4), then Runtime → Factory reset runtime and re-run.
  2. Invalid character errors or unexpected filtering: Your FASTA contains non-ATCG characters (e.g., R, Y, W). Pre-process with clean_seq.py from TIPs-VF, or set include_N = "yes" to include ambiguous entries.
  3. Fewer sequences than expected in output: By default, entries with non-ATCG characters are removed. Check Step 4 output for a count of filtered entries.
  4. Download did not start: Re-run Step 8 only. Or manually navigate to /content/covary_results in the Files panel.
  5. Inconsistent cluster positions across t-SNE runs: t-SNE is stochastic — results may look different each run. For reproducible analyses, use PCA or UMAP, or fix the random seed if the notebook exposes that parameter.
  6. Sequences with non-uniform start positions: Use Seed Aligner to standardize entry points before running Covary.

Companion tools in the Covary ecosystem

Covary is part of a broader toolkit. Depending on your research question, you may find these companion tools useful:

  • Covary-encoder — the underlying k-mer encoding engine. A non-overlapping, frequency-independent encoding logic that captures sequence, length, positional, and translation-aware attributes.
  • Seed Aligner — detects a common seed region across sequences and reorders them to start at the same point. Standardizes FASTA inputs without full MSA.
  • Mutagen-PX — simulates tumor-specific gene sequence profiles by applying patient mutation data from TCGA cohorts to a reference sequence. Generates "mutated" FASTA outputs per patient for comparative genomics.

Citing Covary

If you use Covary in your research, please cite the following:

De los Santos, M. et al. Covary: A translation-aware framework for alignment-free phylogenetics using machine learning. bioRxiv, 2025. https://doi.org/10.1101/2025.11.13.687960

Where to go from here

Questions, bugs, or feature suggestions? Open an issue on GitHub or reach out via the Covary contact form.

D
Dexter

Hi, I’m Dexter 😎 I handle resource management at ChordexBio—building tutorials, guides, and technical content that actually make sense. I like breaking down complex ideas into clear, usable write-ups, whether it’s for onboarding, research workflows, or product documentation.