What Is Computational Biology?

Biology is increasingly becoming a data science.

Modern sequencing technologies can generate enormous quantities of DNA and protein sequence data. Researchers can now study thousands of genomes, compare entire populations, characterize complex microbial communities, and investigate biological systems at scales that would have been difficult to imagine only a few decades ago.

But generating biological data is only the beginning.

The real challenge is learning how to turn that data into information that can answer a biological question.

That is where computational biology comes in.

Computational biology combines biology, mathematics, statistics, computer science, and increasingly artificial intelligence to analyze biological data and investigate biological systems.

This learning path is designed for students, biologists, researchers, and other learners who want to build a practical foundation in computational biology without having to learn everything at once.

Where Should a Beginner Start?

Computational biology can initially feel overwhelming because it contains many different disciplines.

You may encounter:

  • DNA and protein sequences
  • FASTA files
  • Sequence alignment
  • Genome assembly
  • Phylogenetics
  • Statistics
  • Python and R
  • Machine learning
  • Neural networks
  • Sequence embeddings
  • Genomic databases

The good news is that you do not need to master all of these topics simultaneously.

A much better approach is to learn them as a connected workflow.

A useful mental model is: 

Biological question
        ↓
Biological data
        ↓
Data representation
        ↓
Computational analysis
        ↓
Visualization
        ↓
Biological interpretation

The objective of this program is to help you understand each part of that workflow.

Stage 1 — Learn to Read Biological Sequences

The first skill in computational biology is surprisingly simple:

Learn to work with sequence data.

DNA sequences are commonly represented using the nucleotide alphabet: 

A
T
C
G

Protein sequences use a larger alphabet representing amino acids.

Although these sequences look like simple text, they contain biological information about organisms, genes, proteins, evolutionary relationships, and biological function.

FASTA Files

One of the first file formats you should become comfortable with is FASTA.

A simple FASTA file looks like this: 

>sequence_001
ATGCGTACGATCGATCGATCG

>sequence_002
ATGCGTACGATCGATCAATCG

The line beginning with > is the sequence identifier, while the following lines contain the sequence itself.

Once you understand FASTA, you can begin working with real biological datasets.

What to Learn

  • How FASTA files are structured.
  • How to inspect sequence length.
  • How to calculate basic nucleotide composition.
  • How to identify ambiguous characters.
  • How to work with multiple sequence records.

These may seem like simple skills, but they form the foundation for nearly every downstream sequence-analysis workflow.

Stage 2 — Learn How Sequences Are Compared

Once you can read sequences, the next question is:

How do we determine whether two sequences are similar?

One traditional answer is sequence alignment.

Alignment attempts to arrange sequences so that corresponding positions can be compared.

For example: 

ATGCGTACGATCG
ATGCGTACGATCA
ATGCGTACGTTCA

Aligned sequences allow researchers to investigate substitutions, insertions, deletions, and conserved positions.

This concept is central to classical bioinformatics.

Algorithms Worth Learning

  • Needleman-Wunsch for global sequence alignment.
  • Smith-Waterman for local sequence alignment.
  • BLAST for sequence similarity searching.
  • Multiple sequence alignment for comparing groups of related sequences.

You do not need to memorize every mathematical detail when starting out. Focus first on understanding what problem each algorithm solves and why that problem matters biologically.

Stage 3 — Understand How Genomes Become Data

A computer cannot reason about DNA in the same way a biologist does.

To perform computational analysis, biological sequences must be transformed into representations that algorithms can process.

One of the most important ideas to learn is the concept of a k-mer.

A k-mer is simply a sequence fragment of length k.

For example, given: 

ATCGTACG

the 4-mers are: 

ATCG
TCGT
CGTA
GTAC
TACG

Counting and analyzing these fragments allows a genome to be transformed into numerical information.

This idea is fundamental to many areas of computational genomics, including genome assembly, metagenomics, sequence classification, and machine learning.

If you are new to k-mers, continue with:

Understanding k-mers: The Foundation of Modern Genome Analysis

Stage 4 — Learn Phylogenetics

Once you understand sequence comparison, the next natural question is:

How can we use sequence information to study evolutionary relationships?

This leads to phylogenetics.

A phylogenetic tree represents relationships among biological entities based on a particular dataset and inference method.

A simplified workflow might look like: 

DNA sequences
      ↓
Multiple sequence alignment
      ↓
Evolutionary model
      ↓
Phylogenetic inference
      ↓
Tree

Tools such as FastTree can construct phylogenetic trees from aligned DNA or protein sequences.

However, learning phylogenetics is about more than learning a command.

You should also understand:

  • What a phylogenetic tree represents.
  • What branch lengths mean.
  • What internal nodes represent.
  • What support values mean.
  • Why tree rooting matters.
  • Why alignment quality affects phylogenetic inference.

A useful beginner resource is:

Getting Started with FastTree: Building Phylogenetic Trees from Sequence Alignments

Stage 5 — Discover Alignment-Free Genomics

Traditional computational biology often follows an alignment-first workflow.

But alignment is not the only way to compare biological sequences.

Alignment-free genomics uses alternative representations and statistical or machine learning methods to compare sequences without explicitly constructing a multiple sequence alignment.

Instead of asking:

"Which nucleotide in sequence A corresponds to which nucleotide in sequence B?"

alignment-free methods can ask:

"How similar are these sequences in their computational representation?"

This can be particularly valuable when working with very large or highly diverse datasets.

Learn more:

What Are Alignment-Free Genomics and Why Is It Transforming Genome Analysis?

Stage 6 — Learn How Machine Learning Represents Biology

Once biological sequences have been converted into numerical representations, machine learning becomes possible.

At its simplest, a machine learning workflow looks like: 

Biological sequences
        ↓
Numerical representation
        ↓
Machine learning model
        ↓
Prediction / clustering / visualization

The representation step is extremely important.

A model can only learn from the information that its input representation makes available.

This is why computational biology increasingly focuses on representation learning.

Instead of manually defining every feature that a model should examine, representation-learning approaches attempt to learn useful features from the biological data itself.

Concepts to Explore

  • Feature vectors
  • Dimensionality reduction
  • Principal Component Analysis (PCA)
  • Clustering
  • Neural networks
  • Embeddings
  • Self-supervised learning
  • Transformers

Stage 7 — Learn to Visualize High-Dimensional Biology

Biological datasets can contain hundreds, thousands, or millions of measurements.

Humans cannot easily visualize a dataset containing hundreds of dimensions.

Dimensionality-reduction methods help convert high-dimensional data into two- or three-dimensional representations that researchers can explore visually.

Three techniques worth learning are:

PCA

Principal Component Analysis identifies directions of variation in a dataset and projects the data onto a smaller number of dimensions.

t-SNE

t-SNE is particularly useful for exploring local neighborhoods and potential clusters in high-dimensional datasets.

UMAP

UMAP is another nonlinear dimensionality-reduction technique that can reveal local and global structure in complex datasets.

These methods appear frequently in modern genomics and machine learning workflows.

But remember:

A visualization is not automatically a biological conclusion.

Clusters should be interpreted using metadata, biological knowledge, experimental design, and independent evidence.

Stage 8 — Learn Basic Programming

You do not need to become a software engineer to become effective in computational biology.

However, learning some programming can dramatically increase what you can do with biological data.

Python is an especially useful starting point because it has a large ecosystem of scientific and bioinformatics libraries.

Start with:

  • Variables
  • Lists and dictionaries
  • Loops
  • Functions
  • Reading files
  • Working with strings
  • Basic data analysis
  • Plotting

Then move into biological libraries such as Biopython and scientific libraries such as NumPy, pandas, and matplotlib.

The goal is not to write sophisticated software immediately.

The goal is to become comfortable enough with code that you can automate repetitive biological analyses and investigate datasets yourself.

Stage 9 — Learn to Think Like a Computational Biologist

Learning tools is useful, but computational biology is ultimately about asking good questions.

Before running an analysis, ask:

  • What biological question am I trying to answer?
  • What data would actually answer that question?
  • What assumptions does my method make?
  • What information might my representation lose?
  • Could technical variation create the observed pattern?
  • How can I validate the result independently?

For example, suppose a dimensionality-reduction plot produces three distinct clusters.

It may be tempting to immediately conclude that the clusters represent three biological groups.

But there are many possibilities.

The clusters could reflect:

  • Species differences.
  • Geographic differences.
  • Experimental batches.
  • Sequencing technologies.
  • Sample preparation.
  • Sequence length differences.
  • Data preprocessing.

Computational biology therefore requires both computational reasoning and biological reasoning.

Stage 10 — Move From Tools to Workflows

The most important transition in your learning journey happens when you stop thinking about individual software tools and start thinking about complete workflows.

For example: 

Question
  ↓
Collect sequences
  ↓
Quality control
  ↓
Choose representation
  ↓
Select computational method
  ↓
Analyze
  ↓
Visualize
  ↓
Validate
  ↓
Interpret

A good computational biologist understands why each step exists.

The specific software can change. The underlying reasoning remains.

A Suggested Learning Sequence

If you are starting from zero, the following sequence provides a practical progression:

  1. Biological sequence fundamentals — DNA, RNA, proteins, genes, genomes.
  2. FASTA and biological data formats — learn to inspect and manipulate sequence data.
  3. Python fundamentals — learn enough programming to automate analysis.
  4. Sequence alignment — understand the classical approach to sequence comparison.
  5. k-mer analysis — learn how sequences can become numerical representations.
  6. Phylogenetics — learn how sequence relationships can be represented as trees.
  7. Alignment-free genomics — explore alternatives to alignment-based analysis.
  8. Machine learning fundamentals — understand features, models, training, and evaluation.
  9. Dimensionality reduction and embeddings — learn how high-dimensional biological representations can be explored.
  10. AI for genomics — investigate modern representation-learning approaches.

Where ChordexBio Fits Into This Learning Path

ChordexBio's research and technology ecosystem sits at the intersection of several of these areas.

The goal is not simply to apply artificial intelligence to biology because AI is fashionable. The deeper question is how biological sequences can be represented computationally in ways that allow algorithms to uncover useful structure.

This is reflected in several ChordexBio initiatives.

TIPs

The TIPs framework explores sequence representation and translation-aware approaches for biological data.

Covary

Covary applies these ideas to alignment-free genomic analysis, allowing researchers to explore sequence relationships through machine-learning-based representations.

Other ChordexBio Resources

The broader ChordexBio ecosystem also includes tools, research programs, educational materials, and computational platforms designed to make advanced biological analysis more accessible.

The Learning Hub is intended to provide the conceptual foundation needed to understand these technologies rather than treating them as black-box tools.

What You Should Be Able to Do After This Program

You do not need to become an expert in every topic covered here.

A strong beginner-level outcome is being able to look at a biological dataset and answer questions such as:

  • What kind of biological data am I looking at?
  • How is the data represented?
  • What preprocessing is required?
  • Should I use alignment or an alignment-free approach?
  • What computational method matches my biological question?
  • What does the resulting visualization actually tell me?
  • What assumptions does the method make?
  • How can I validate the result?

Once you can answer these questions, you have moved beyond simply operating bioinformatics software.

You are beginning to think computationally about biology.

A Note About AI in Computational Biology

Artificial intelligence is changing computational biology rapidly, but AI should not be treated as a shortcut around biological understanding.

A sophisticated model cannot compensate for a poorly designed experiment, inappropriate data, or an unclear biological question.

In fact, the more powerful computational methods become, the more important it becomes to understand their assumptions and limitations.

The most valuable researchers will therefore be those who can connect three things: 

Biological understanding
        +
Computational reasoning
        +
Machine learning

That combination is at the heart of modern computational biology.

Your Next Steps

If you are beginning your computational biology journey, don't try to learn everything in one week.

Start with biological sequences.

Learn FASTA.

Write a small Python script.

Compare a few sequences.

Build a simple tree.

Explore a k-mer representation.

Visualize a dataset.

Then gradually introduce machine learning.

Each step builds on the previous one.

The objective is not to memorize a collection of bioinformatics commands. It is to develop an intuition for how biological information moves from sequence → representation → computation → visualization → biological insight.

Continue Learning With ChordexBio

The ChordexBio Learning Hub will continue expanding this pathway with practical tutorials, algorithm explainers, tool guides, datasets, and research-oriented learning materials.

Start with these resources:

You can also explore Covary to see how alignment-free genomic analysis can be applied through a web-based workflow.

Final Takeaway

Computational biology is not one subject. It is a way of combining biological questions with computational methods to extract useful information from complex biological data.

The field can seem enormous when viewed all at once. But when approached as a sequence of connected concepts, it becomes much easier to navigate.

Start with sequences.

Learn how they are represented.

Understand how they can be compared.

Learn how algorithms transform them into information.

Then explore how machine learning can discover patterns in those representations.

That progression—from DNA to data to insight—is the foundation of modern computational biology.

D
Dexter

Hi, I’m Dexter 😎 I handle resource management at ChordexBio—building tutorials, guides, and technical content that actually make sense. I like breaking down complex ideas into clear, usable write-ups, whether it’s for onboarding, research workflows, or product documentation.